Identificación molecular por PCR y nested PCR de rickettsias en Crassostrea gigas.

Show simple item record

dc.contributor.advisor Ordinola Zapata, Alberto
dc.contributor.author Saavedra Olivos, Katherine Yuiliana
dc.date.accessioned 2018-01-11T20:13:14Z
dc.date.available 2018-01-11T20:13:14Z
dc.date.issued 2012
dc.identifier.uri http://repositorio.untumbes.edu.pe/handle/UNITUMBES/140
dc.description.abstract La presente investigación se realizó del 5 de diciembre del 2011 al 20 de marzo del 2012 en el Laboratorio de Biología Molecular de la Facultad de Ingeniería Pesquera de la Universidad Nacional de Tumbes. Se pretendió determinar si los primers diseñados para PCR: CXcFw1 (CGGAAGGCAGCAGTAGGG) /CXcRev3 (CCGGGACTTTTTCTGTGGG) y nested-PCR: CxcFw1 (CGGAAGGCAGCAGTAGGG)/CXcRev4 (TATCTAAT CCTGTTTGCTCCCC) y CXcFw1/CXcRev2 (CGGAAGGCAGCAGTAGGG/ ACTTACTAAACCACCTACACACCC) permitirían detectar un fragmento del gen 16S ARNr en rickettsias en Crassostrea gigas. Para ello se realizó la extracción de ADN de muestras de branquias y masa visceral de C. gigas siguiendo el protocolo CTAB y para verificar la extracción adecuada se realizó una amplificación del gen de referencia de actina mediante PCR utilizando los primers Bi-actin-Fw y Bi-actin-Rev. Los resultados indican que la extracción de ADN fue adecuada pues se logró amplificar el gen de la actina, sin embargo los primers ensayados tanto para PCR como nested-PCR no permitieron detectar rickettsias en C. gigas, pero si permitieron amplificar el fragmento del gen 16S ARNr de una muestra de Ostrea iridescens correspondiente a una bacteria, que según la búsqueda realizada en GenBank, correspondió a una bacteria no cultivable (similitud de 94 %) y no emparentada con ninguna de las rickettsias cuyas secuencias están depositadas en dicha base de datos (similitud de 84 %). Se concluye que los primers ensayados tanto para PCR como nested-PCR no pudieron detectar rickettsias en las muestras analizadas, ya sea porque procedieron de C. gigas no infectadas o porque los primers no tuvieron la suficiente especificidad para detectarlas. Se recomienda realizar ensayos de detección de rickettsias utilizando primers diseñados para detectar otros genes tales como los genes que codifican las proteínas rOmpA y rOmpB, el gen gltA que codifica la citrato sintasa y el gen D. es_ES
dc.description.uri Tesis es_ES
dc.format application/pdf es_ES
dc.language.iso spa es_ES
dc.publisher Universidad Nacional de Tumbes es_ES
dc.rights info:eu-repo/semantics/openAccess es_ES
dc.rights.uri https://creativecommons.org/licenses/by/4.0/ es_ES
dc.source Universidad Nacional de Tumbes es_ES
dc.source Repositorio Institucional - UNTumbes es_ES
dc.subject rickettsias es_ES
dc.subject Crassostrea gigas es_ES
dc.subject identificación molecular es_ES
dc.subject 16s ARNr es_ES
dc.subject PCR es_ES
dc.subject Nested-PCR es_ES
dc.title Identificación molecular por PCR y nested PCR de rickettsias en Crassostrea gigas. es_ES
dc.type info:eu-repo/semantics/bachelorThesis es_ES
thesis.degree.name Ingeniero Pesquero es_ES
thesis.degree.grantor Universidad Nacional de Tumbes.Facultad de Ingeniería Pesquera y Ciencias del Mar es_ES
thesis.degree.level Título Profesional es_ES
thesis.degree.discipline Ingeneria Pesquera es_ES
thesis.degree.program Escuela Profesional Ingeniería Pesquera es_ES
dc.subject.ocde Ciencias Veterinarias es_ES


Files in this item

This item appears in the following Collection(s)

Show simple item record

info:eu-repo/semantics/openAccess Except where otherwise noted, this item's license is described as info:eu-repo/semantics/openAccess

Guías

Search DSpace


Browse

My Account